SIST EN 17882:2024
(Main)Food authenticity - DNA barcoding of meat derived from mammals and birds using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
General Information
- Abstract
This document specifies a method for the identification of meat derived from mammals and birds to the level of genus or species and allows the identification of a large number of commercially important as well as exotic meat species using DNA barcoding.
This method was validated on DNA isolated from single pieces of raw meat. This method can also be used for the identification of single meat animal species in some processed products.
The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex meat products containing mixtures of two or more meat species.
The identification of meat species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.
- Status
- Published
- Public Enquiry End Date
- 17-Oct-2022
- Publication Date
- 11-Aug-2024
- Technical Committee
- KŽP - Agricultural food products
- Current Stage
- 6060 - National Implementation/Publication (Adopted Project)
- Start Date
- 25-Jul-2024
- Due Date
- 29-Sep-2024
- Completion Date
- 12-Aug-2024
Overview
EN 17882:2024 (CEN) specifies a harmonized DNA barcoding method for the identification of meat derived from mammals and birds. The standard uses defined mitochondrial gene segments - cytochrome b (cytb) and cytochrome c oxidase I (cox1 / COI) - amplified by PCR and sequenced to assign samples to genus or species. The method was validated on DNA from single pieces of raw meat and is intended to support food authenticity testing and the detection of mislabeling or fraud.
Key topics and technical requirements
- Targets and amplicons: PCR amplification of ~359 bp of the cytb gene and/or ~540 bp of the cox1 gene. A degenerated reverse primer is used for cox1 to broaden species coverage.
- Molecular workflow: sample preparation → DNA extraction → PCR amplification → electrophoretic evaluation → sequencing of PCR products → sequence comparison with public databases for species assignment.
- Sequence analysis: assignment to species or genus based on identity and query coverage against database entries (e.g., BOLD and other curated repositories).
- Reagents & apparatus: molecular-grade reagents, thermostable DNA polymerase or master mixes, dNTPs, specified oligonucleotides (see standard for cytb and cox1 primer sequences), agarose gels, DNA size standards, thermocycler, spectrophotometer/fluorometer and DNA sequencer.
- Validation & performance: the standard includes validation status, performance criteria, and guidance on interpretation of database query results.
- Limitations: unsuitable for highly processed foods with severely degraded DNA (insufficient fragment length for target amplification) and not applicable to complex products containing mixtures of two or more meat species.
Practical applications
- Food authenticity testing to confirm species declared on labels and detect substitution or adulteration of meat (commercial and exotic species).
- Regulatory enforcement by national food authorities and customs for compliance and consumer protection.
- Quality control in food manufacturing, retail and catering where single-animal meat pieces are analysed.
- Forensic and research use where species-level identification of mammalian and avian meat is required.
Who should use this standard
- Accredited food testing laboratories and molecular diagnostics labs
- Public health and food safety authorities
- Food industry quality assurance teams
- Research institutions working on food traceability and fraud detection
Related standards
- ISO 16577 - vocabulary for molecular biomarker methods
- EN ISO 20813 - general requirements for nucleic acid–based methods for animal species detection
- ISO 21571 - guidance on DNA extraction methods (referenced for sample processing and extraction)
EN 17882:2024 provides a standardized, validated DNA barcoding procedure that supports reliable species identification of mammal and bird meat where DNA integrity and single-species samples permit accurate PCR amplification and sequencing.
Relations
- Effective Date
- 28-Jan-2026
- Effective Date
- 28-Jan-2026
Get Certified
Connect with accredited certification bodies for this standard

BSI Group
BSI (British Standards Institution) is the business standards company that helps organizations make excellence a habit.

Bureau Veritas
Bureau Veritas is a world leader in laboratory testing, inspection and certification services.

DNV
DNV is an independent assurance and risk management provider.
Sponsored listings
Frequently Asked Questions
SIST EN 17882:2024 is a standard published by the Slovenian Institute for Standardization (SIST). Its full title is "Food authenticity - DNA barcoding of meat derived from mammals and birds using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments". This standard covers: This document specifies a method for the identification of meat derived from mammals and birds to the level of genus or species and allows the identification of a large number of commercially important as well as exotic meat species using DNA barcoding. This method was validated on DNA isolated from single pieces of raw meat. This method can also be used for the identification of single meat animal species in some processed products. The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex meat products containing mixtures of two or more meat species. The identification of meat species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.
This document specifies a method for the identification of meat derived from mammals and birds to the level of genus or species and allows the identification of a large number of commercially important as well as exotic meat species using DNA barcoding. This method was validated on DNA isolated from single pieces of raw meat. This method can also be used for the identification of single meat animal species in some processed products. The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex meat products containing mixtures of two or more meat species. The identification of meat species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.
SIST EN 17882:2024 is classified under the following ICS (International Classification for Standards) categories: 07.080 - Biology. Botany. Zoology; 35.040.50 - Automatic identification and data capture techniques; 67.020 - Processes in the food industry; 67.120.10 - Meat and meat products. The ICS classification helps identify the subject area and facilitates finding related standards.
SIST EN 17882:2024 has the following relationships with other standards: It is inter standard links to kSIST FprEN 890:2026, SIST EN ISO 20813:2023. Understanding these relationships helps ensure you are using the most current and applicable version of the standard.
SIST EN 17882:2024 is associated with the following European legislation: EU Directives/Regulations: 2017/625, 882/2004. When a standard is cited in the Official Journal of the European Union, products manufactured in conformity with it benefit from a presumption of conformity with the essential requirements of the corresponding EU directive or regulation.
SIST EN 17882:2024 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.
Standards Content (Sample)
SLOVENSKI STANDARD
01-september-2024
Pristnost živil - Črtno kodiranje DNK mesa, pridobljenega iz sesalcev in ptic, z
uporabo definiranih mitohondrijskih genskih segmentov citokroma b in citokroma
c oksidaze I
Food authenticity - DNA barcoding of meat derived from mammals and birds using
defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von
Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom
c Oxidase-I-Gensegmente
Authenticité des aliments - Codage à barres de l'ADN de viande dérivée de mammifères
et d'oiseaux à l'aide de segments définis du gène du cytochrome b mitochondrial et de la
cytochrome c oxydase I
Ta slovenski standard je istoveten z: EN 17882:2024
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.10 Meso in mesni proizvodi Meat and meat products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
EN 17882
EUROPEAN STANDARD
NORME EUROPÉENNE
July 2024
EUROPÄISCHE NORM
ICS 07.080; 67.020; 67.120.10
English Version
Food authenticity - DNA barcoding of meat derived from
mammals and birds using defined mitochondrial
cytochrome b and cytochrome c oxidase I gene segments
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von Fleisch
de viande dérivée de mammifères et d'oiseaux à l'aide und Fleischerzeugnissen von Säugetieren und Vögeln
de segments définis du gène du cytochrome b anhand definierter mitochondrialer Cytochrom b und
mitochondrial et de la cytochrome c oxydase I Cytochrom c Oxidase-I-Gensegmente
This European Standard was approved by CEN on 17 June 2024.
CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 17882:2024 E
worldwide for CEN national Members.
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 7
5 Principle . 7
6 Reagents and materials . 7
7 Apparatus . 8
8 Procedure . 8
8.1 Sample preparation . 8
8.2 DNA extraction . 9
8.3 PCR . 9
8.4 Evaluation of PCR products . 10
8.5 Evaluation of the PCR results . 10
9 Sequencing . 11
9.1 Sequencing of PCR products. 11
9.2 Evaluation of sequence data . 11
9.3 Comparison of the sequence with public databases . 12
10 Interpretation of database query results . 14
11 Validation status and performance criteria . 14
12 Test report . 19
Bibliography. 20
European foreword
This document (EN 17882:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by January 2025, and conflicting national standards shall
be withdrawn at the latest by January 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Fraudulent adulteration of meat in food threatens both public safety and commerce. It can affect those
adhering to ethnological dietary rules, economic development and social stability. In the last three
decades, globalization has taken place in the trade of food. Meat trade channels are becoming steadily
longer and more complicated so that sophisticated traceability tools are needed to ensure food safety.
Correct food labelling is a prerequisite to ensure safe meat products and fair trade. The development of
reliable, harmonized and standardized protocols for the authentication of meat and meat products is
necessary to ensure consumer protection and the detection of potential food fraud.
1 Scope
This document specifies a method for the identification of meat derived from mammals and birds to the
level of genus or species and allows the identification of a large number of commercially important as
well as exotic meat species using DNA barcoding.
This method was validated on DNA isolated from single pieces of raw meat. This method can also be used
for the identification of single meat animal species in some processed products.
The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA
where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not
applicable for complex meat products containing mixtures of two or more meat species.
The identification of meat species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both,
followed by sequencing of the PCR products and subsequent sequence comparison with entries in
databases.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions (ISO 20813)
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
sequence alignment
arrangement of nucleic acid sequences or protein sequences according to regions of similarity
Note 1 to entry: The sequence alignment is a process or result of matching up the nucleotide residues of two or
more biological sequences to achieve maximal levels of identity.
[SOURCE: ISO 16577:2022, 3.7.18 – modified, Note 1 to entry added, alternative name added]
3.2
FASTA format
text-based format for representing either nucleotide sequences or amino acid (protein) sequences, in
which nucleotides or amino acids are represented using single-letter codes
Note 1 to entry: A sequence in FASTA format begins with a single-line description, followed by lines of sequence
data. The description line (defline) is distinguished from the sequence data by a greater-than (“>”) symbol at the
beginning.
Note 2 to entry: An example sequence in FASTA format is:
>Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTC
TCAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACAT
TATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAAC
ATACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTA
TTCATAGAGACCTGAAACATTGGAGTTGTACTATTCCTTTTAGTAATAATGACCGCCTTCGTAGGCTACGTCCTCCCT
Note 3 to entry: Blank lines are not allowed in the middle of FASTA input. Sequences are represented in the
standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions:
— lower-case letters are accepted and are mapped into upper-case;
— a single hyphen or dash can be used to represent a gap of indeterminate length.
It is common to end the sequence with an “*” (asterisk) character and to leave a blank line between the description
and the sequence.
[SOURCE: ISO 16577:2022, 3.1.2, modified – Last sentence in Note 1 to entry removed, another example
is used in Note 2 to entry, 3rd bullet point in note 3 to entry deleted]
3.3
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
Note 1 to entry: In the sequence database of Barcode of Life (BOLD), the term similarity is used instead of identity.
3.4
query
sequence (or other type of search term) that is compared to entries in a database
3.5
query coverage
percentage of the query covered by alignment to the data base sequence
3.6
sequence similarity
identity between two or more DNA sequences measured as a percentage
[SOURCE: ISO 16577:2022, 3.7.21]
3.7
specificity
analytical specificity
diagnostic specificity
ability of a detection method to distinguish the specific organism or pathogen from other organisms,
whether related or not, and the extent to which the analysis can distinguish known or unknown variants
of the organism
Note 1 to entry: Specificity is a term that describes the same phenomenon as selectivity but in a different way;
while selectivity is applied to analytical chemistry and physics, specificity is applied to organisms and pathogens.
[SOURCE: ISO 16577:2022, 3.3.76]
4 Symbols and abbreviations
cox1, cytochrome c oxidase I gene
syn COI
cytb cytochrome b gene
bp base pairs
dNTP deoxyribonucleotide triphosphate
DNA deoxyribonucleic acid
PCR polymerase chain reaction
A adenine
C cytosine
G guanine
T thymine
Y pyrimidine (cytosine or thymine)
5 Principle
DNA is extracted from meat and meat products derived from mammals or birds applying a suitable
method. Segments of approximately 359 base pairs of cytb and/or approximately 540 base pairs of cox1
are amplified by PCR. Amplification of cox1 uses a degenerated reverse primer to increase the number of
species that are able to be detected by the method. The nucleotide sequences of the PCR products are
determined by a suitable DNA sequencing method, e.g. Sanger sequencing. The PCR primers used to
generate the cytb and cox1 amplicon are also used for sequencing. The determined sequences are
evaluated by comparison to sequence entries in databases, thus allowing the assignment to a meat
species or genus according to the degree of identity with the available sequences.
The decision whether the cytb or cox1 gene segment or both are used for meat identification depends on
the declared meat species, the applicability of the PCR method for the meat species and the availability of
comparative sequences in the public databases.
6 Reagents and materials
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled, demineralized or water of equivalent purity, according to EN ISO 20813. Laboratory
organization shall follow EN ISO 20813.
6.1 Thermostable DNA polymerase.
During the collaborative study the Maxima® Hot Start PCR Master Mix (2 x) of Fermentas GmbH (ready to use
PCR buffer solution including thermostable DNA polymerase) was used for the cytb amplification and the BIOTAQ™
DNA polymerase of Bioline with 10 x reaction buffer and separate MgCl solution for the cox1 amplification. In
addition to the recommended BIOTAQ™ DNA polymerase other mastermixes and polymerases were successfully
used in the collaborative study. This information is given for the convenience of users of this document and does
6.2 PCR reaction buffer (including MgCl or with separate MgCl solution).
2 2
6.3 dNTP mix (dATP, dCTP, dGTP and dTTP).
6.4 Oligonucleotides, see Tables 1 and 2.
[1]
Table 1 — Oligonucleotides for amplification of the cytb gene region
Name DNA sequence of oligonucleotide
cytB-1 5'-CCA TCC AAC ATC TCA GCA TGA TGA AA-3'
cytB-2 5'-GCC CCT CAG AAT GAT ATT TGT CCT CA-3'
[2]
Table 2 — Oligonucleotides for amplification of the cox1 gene region
Name DNA sequence of oligonucleotide
CO1e-H 5'-CCA GAG ATT AGA GGG AAT CAG TG-3'
CO1f-L 5'-CCT GCA GGA GGA GGA GAY CC-3'
NOTE The abbreviation of the DNA bases in Tables 1 and 2 are based on the recommendations for unambiguous,
uniform, and consistent nomenclature, published by the International Union of Pure and Applied Chemistry
[3]
(IUPAC) .
6.5 Agarose.
6.6 DNA size standard.
7 Apparatus
In addition to standard laboratory equipment, the following apparatus should be used.
7.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA.
7.2 Thermocycler.
7.3 Gel electrophoresis device.
7.4 Gel documentation system.
7.5 DNA sequencer.
8 Procedure
8.1 Sample preparation
The test portion used for DNA extraction shall be representative of the laboratory sample. In samples that
consist of processed materials (e.g. convenience foods), single meat pieces shall be separated and
analysed. For the analysis of samples composed of several pieces, test portions for every putative meat
not constitute an endorsement by CEN of the products named. Equivalent products may be used if they can be shown
to lead to the same results.
dNTPs can also be part of a commercial PCR master mix.
species are taken and analysed separately. To minimize the risk of amplifying adhering contaminants,
test sample material shall not be taken from the surface of the laboratory sample, see also EN ISO 20813.
8.2 DNA extraction
[4]
General instructions and measures described in ISO 21571 should be followed for the extraction of
DNA from the test sample. For example, the DNA extraction methods described in ISO 21571:2005,
[4]
Annex A , can be used. Commercial kits can be used for the extraction and purification of DNA, if their
applicability for the extraction of DNA from meat has been experimentally confirmed.
8.3 PCR
8.3.1 General
The primers are used for amplification of segments from the mitochondrial cytb and cox1.
The primers used for the amplification of the vertebrate mitochondrial cytb fragment flank a variable cytb
[1]
region .
The primers used for the amplification of the mitochondrial cox1 fragment were designed to amplify a
[2]
segment from the 5' region of cox1 .
8.3.2 PCR setup
The method was validated for a total volume of 25 µl per PCR. The reagents given in Table 3 shall be used
for the cytb and cox1 PCR, respectively.
Reagents shall be thawed completely and centrifuged briefly before usage. A PCR reagent mixture is
prepared containing all PCR components in the given concentrations except for the DNA extract or the
controls. The amount of PCR mixture prepared depends on the total volume per PCR and the total number
of reactions including a sufficient pipetting reserve.
Positive PCR results are expected when using a DNA concentration of approximately 1 ng DNA per μl of
the final reaction solution (25 ng total DNA).
To improve the PCR result the DNA quantity can be increased (e.g. to increase the yield of PCR product)
or decreased (e.g. to avoid PCR inhibition).
Table 3 — Components for the cytb and cox1 PCR
Reagent (stock solution) Final composition in the reaction solution
PCR buffer 1 x
a
1,5 mmol/l
MgCl
a
0,2 mmol/l for each dNTP
dNTP mix
b
500 nmol/l
Forward Primer
b
500 nmol/l
Reverse Primer
Thermostable DNA 0,5 units to 1 unit
a
Polymerase
Water Add to obtain final volume
Sample DNA About 1 ng/µl
a
Use reagent only if not already included in the PCR master mix.
b
see Table 1 for cytb PCR and Table 2 for cox1 PCR
Mix the PCR reagent mixture, centrifuge briefly and split into the individual reactions. Pipette the DNA
extracts to be examined or the PCR controls (see 8.3.4) into the different reaction solutions.
For further information on PCR controls, see also EN ISO 20813.
8.3.3 PCR controls
In addition to the reaction setups for the samples to be analysed, an amplification reagent control and an
extraction blank control (according to EN ISO 20813) shall be included.
A positive DNA target control (see EN ISO 20813) can be used to demonstrate the ability of the PCR to
amplify the target sequence. As positive control material, genomic DNA extracted from a known meat
species or an available plasmid containing the target sequence can be used.
If a sample shows no amplification an inhibition control reaction should be performed to exclude an
inhibition of the PCR as the cause (see EN ISO 20813). This can be done either by dilution of sample DNA
or by using an internal inhibition control assay.
Additional PCR controls can be used, see EN ISO 20813.
8.3.4 Thermal cycling
Transfer the reaction setups into the thermocycler and start the temperature-time program. The
temperature-time program as outlined in Table 4 has been successfully used in the collaborative study.
NOTE The use of different reagent conditions and thermocyclers can require specific optimization. The time
for initial denaturation depends on the thermostable polymerase used.
Table 4 — Temperature-time program for the cytb and cox1 PCR
Step Parameter Temperature Time Cycles
Initial denaturation and
activation of the hot-start DNA
1 95 °C 15 min 1
polymerase (if used)
Denaturation 95 °C 40 s
2 Amplification Annealing 50 °C 80 s 35
Elongation 72 °C 80 s
3 Final elongation 72 °C 3 min 1
After the PCR thermal cycling is finished, follow with the evaluation of the PCR products or store samples
in the refrigerator until further analysis.
8.4 Evaluation of PCR products
The PCR product should be assessed for quality, and its quantity estimated, e.g. by agarose gel
electrophoresis.
Gel electrophoresis of DNA in an agarose gel is a standard technique in molecular biology. Therefore, only
general conditions that need to be adapted to each laboratory are suggested.
A volume of 1 µl to 10 µl of each PCR product is separated in, for example, an agarose gel of suitable
concentration (e.g. a mass fraction of 1 % to 2 % per volume) and evaluated with a gel documentation
system. In one lane an appropriate DNA size standard is included for comparison.
8.5 Evaluation of the PCR result
...



