EN 17882:2024

SLOVENSKI STANDARD
oSIST prEN 17882:2022
01-oktober-2022
Avtentičnost hrane - Črtno kodiranje DNK mesa in mesnih izdelkov, pridobljenih iz
sesalcev in perutnine, z uporabo segmentov genov, ki nosijo zapis za
mitohondrijski citokrom b in citokrom c oksidaze I
Food authenticity - DNA barcoding of meat and meat products derived from mammalia
and poultry using defined mitochondrial cytochrome b and cytochrome c oxidase I gene
segments
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von
Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom
c Oxidase-I-Gensegmente
Authenticité des aliments - Codage à barres de l'ADN de viande et de produits carnés
dérivés de mammifères et volailles à l'aide de segments définis du gène du cytochrome
b mitochondrial et de la cytochrome c oxydase I
Ta slovenski standard je istoveten z: prEN 17882
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.10 Meso in mesni proizvodi Meat and meat products
oSIST prEN 17882:2022 en,fr,de
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

oSIST prEN 17882:2022
oSIST prEN 17882:2022
DRAFT
EUROPEAN STANDARD
prEN 17882
NORME EUROPÉENNE
EUROPÄISCHE NORM
July 2022
ICS 07.080; 67.020; 67.120.10
English Version
Food authenticity - DNA barcoding of meat and meat
products derived from mammalia and poultry using
defined mitochondrial cytochrome b and cytochrome c
oxidase I gene segments
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von Fleisch
de viande et de produits carnés dérivés de mammifères und Fleischerzeugnissen von Säugetieren und Vögeln
et volailles à l'aide de segments définis du gène du anhand definierter mitochondrialer Cytochrom b und
cytochrome b mitochondrial et de la cytochrome c Cytochrom c Oxidase-I-Gensegmente
oxydase I
This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee
CEN/TC 460.
If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations
which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.

This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other
language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC
Management Centre has the same status as the official versions.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are
aware and to provide supporting documentation.

Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without
notice and shall not be referred to as a European Standard.

EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION

EUROPÄISCHES KOMITEE FÜR NORMUNG

CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2022 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 17882:2022 E
worldwide for CEN national Members.

oSIST prEN 17882:2022
prEN 17882:2022 (E)
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 7
5 Reagents and materials . 7
5.1 General . 7
5.2 PCR reagents . 8
6 Apparatus . 8
7 Procedure . 9
7.1 Sample preparation . 9
7.2 DNA extraction . 9
7.3 PCR . 9
7.3.1 General . 9
7.3.2 PCR setup . 9
7.3.3 Temperature-time program . 10
7.3.4 PCR controls . 10
8 Evaluation . 11
8.1 Evaluation of PCR products . 11
8.2 Evaluation of the PCR results . 11
8.3 Sequencing of PCR products. 11
8.4 Evaluation of sequence data . 12
8.5 Comparison of the sequence with public databases . 12
8.5.1 General . 12
8.5.2 Sequence comparison of cytb and/or COI DNA sequences with GenBank . 12
8.5.3 Sequence comparison of COI DNA sequences with BOLD . 13
9 Interpretation of database query results . 14
10 Validation status and performance criteria . 14
10.1 Collaborative study for the identification of meat species based on cytb and COI
sequence analysis . 14
11 Test report . 18
Bibliography. 19

oSIST prEN 17882:2022
prEN 17882:2022 (E)
European foreword
This document (prEN 17882:2022) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to the CEN Enquiry.
oSIST prEN 17882:2022
prEN 17882:2022 (E)
Introduction
Fraudulent adulteration of meat in food threatens both public safety and commerce. It can affect those
adhering to ethnological dietary rules, economic development and social stability. In the last three
decades, globalization has taken place in the trade of food. Meat trade channels are becoming steadily
longer and more complicated so that sophisticated traceability tools are needed to ensure food safety.
Correct food labelling is a prerequisite to ensure safe meat products and fair trade.
The development of harmonized and standardized protocols for the authentication of meat products is
necessary to establish reliable methods for the detection of potential food fraud.
oSIST prEN 17882:2022
prEN 17882:2022 (E)
1 Scope
This document describes a procedure for the identification of meat and meat products derived from
mammalia and poultry to the level of genus or species.
The identification of meat species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) [1] or the cytochrome c oxidase I gene (COI) [2], or both, followed
by sequencing of the PCR products and subsequent sequence comparison with entries in databases [3],
[4]. The methodology allows the identification of a large number of frequently used as well as exotic meat
species in foodstuffs.
The decision whether the cytb or COI gene segment or both are used for meat identification depends on
the declared meat species, the applicability of the PCR method for the meat species and the availability of
comparative sequences in the public databases.
This method has been successfully validated on raw meat, however, laboratory experience is available
that it can also be applied to processed meat products.
This document is usually unsuitable for the analysis of highly processed foods with highly degraded DNA
where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not
applicable for complex meat products containing mixtures of two or more meat species.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Terms and definitions
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminological databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
process or result of matching up the nucleotide residues of two or more biological sequences to achieve
maximal levels of identity
[SOURCE: BLAST Glossary]
oSIST prEN 17882:2022
prEN 17882:2022 (E)
3.2
BLAST
Basic Local Alignment Search Tool [3]
sequence comparison algorithm optimized for speed used to search sequence databases for optimal local
alignments to a query
Note 1 to entry: It directly approximates alignments that optimize a measure of local similarity, the maximum
signal pair (MSP) score or high scoring signal pair (HSP) score.
3.3
BOLD
Barcode of Life Data Systems [4]
informatics workbench aiding the acquisition, storage, analysis, and publication of DNA barcode records
Note 1 to entry: By assembling molecular, morphological, and distributional data, it bridges a traditional
bioinformatics chasm. BOLD is freely available to any researcher with interests in DNA barcoding. By providing
specialized services, it aids the assembly of records that meet the standards needed to gain BARCODE designation
in the global sequence databases. Because of its web-based delivery and flexible data security model, it is also well
positioned to support projects that involve broad research alliances.
[SOURCE: BOLDSYSTEMS About Us]
3.4
FASTA format
text-based format for representing either nucleotide sequences or amino acid sequences, which begins
with a single-line description, followed by lines of sequence data
Note 1 to entry: The description line (defline) is distinguished from the sequence data by a greater-than (“>”)
symbol at the beginning.
EXAMPLE An example sequence in FASTA format is shown below:
> Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTCT
CAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACATT
ATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAACA
TACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTATT
CATAGAGACCTGAAACATTGGAGTTG
...