Foodstuffs - DNA barcoding of fish and fish products using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments

This document describes a procedure for the identification of single fish and fish fillets to the level of genus or species.
The identification of fish species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases. The methodology allows the identification of a large number of commercially important fish species.
The decision whether the cytb or cox1 gene segment or both are used for fish identification depends on the declared fish species, the applicability of the PCR method for the fish species and the availability of comparative sequences in the public databases.
This method has been successfully validated on raw fish fillets, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of fish, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex fish products containing mixtures of two or more fish species.

Lebensmittel - DNA-Barcoding von Fisch und Fischprodukten anhand definierter mitochondrialer Cytochrom-b- und Cytochrom-c-Oxidase-I-Genabschnitte

Dieses Dokument legt ein Verfahren für die Identifizierung von Einzelfischen oder Fischfilets auf Gattungs- oder Speziesebene fest.
Die Identifizierung der Fischspezies erfolgt durch PCR-Amplifikation entweder eines Segments des mitochondrialen Cytochrom-b-Gens (cytb) [1] oder des Cytochrom-c-Oxidase-I-Gens (cox1, syn COI) [2], [3] - oder von beiden, gefolgt von der Sequenzierung der PCR-Produkte und einem anschließenden Datenbankabgleich der Sequenzen [4], [5]. Diese Methodik erlaubt die Identifizierung einer großen Zahl kommerziell wichtiger Fischspezies.
Die Entscheidung, ob der cytb- oder der cox1-Genabschnitt oder beide für die Fischidentifizierung herangezogen werden, hängt von der deklarierten Fischspezies, der Anwendbarkeit des PCR-Verfahrens für die Fischspezies und der Verfügbarkeit vergleichbarer Sequenzen in den öffentlichen Datenbanken ab.
Dieses Verfahren wurde erfolgreich an rohen Fischfilets validiert, Laborerfahrungen zeigen jedoch, dass dieses Verfahren auch an verarbeiteten Proben wie z. B. kalt- und heißgeräucherten, gesalzenen, tiefgefrorenen, gekochten, gebratenen und frittierten Proben angewendet werden kann.
Dieses Dokument ist in der Regel ungeeignet für die Untersuchung stark verarbeiteter Lebensmittel - z. B. Fischkonserven mit stark degradierter DNA, bei denen die Fragmentlängen nicht für eine Amplifizierung der Zielsequenzen ausreichen. Außerdem ist es nicht anwendbar auf zusammengesetzte Fischprodukte, die aus mehr als einer Fischspezies bestehen.

Produits alimentaires - Codes-barres d’ADN de poissons et de produits à base de poissons à l’aide de segments de gènes mitochondriaux du cytochrome b et cyctochrome c oxydase I

Le présent document décrit un mode opératoire d’identification au niveau du gène ou de l’espèce des poissons individuels et des filets de poisson.
L’identification des espèces de poisson s’effectue par amplification par réaction de polymérisation en chaîne (PCR : Polymerase Chain Reaction) d’un segment du gène du cytochrome b mitochondrial (cytb) 1], du gène du cytochrome c oxydase I (cox1 ou COI) [2], [3] ou des deux, suivie d’un séquençage des produits de la PCR et d’une comparaison des séquences aux entrées de bases de données [4], [5]. Cette méthodologie permet l’identification d’un grand nombre d’espèces de poisson à forte importance commerciale.
Le choix de l’utilisation de segments de gènes de cytb ou de cox1 ou des deux pour l’identification du poisson dépend de l’espèce de poisson déclarée, de la facilité d’application de la méthode de la PCR à l’espèce de poisson considérée et de la disponibilité des séquences de comparaison dans les bases de données publiques.
Cette méthode a été validée avec succès sur des filets de poisson cru mais des expériences menées en laboratoire montrent qu’elle est également applicable à des échantillons après transformation (fumage à froid ou à chaud, salage, congélation, cuisson, friture, etc.).
Le présent document est de manière générale inadapté à l’analyse d’aliments hautement transformés comme les poissons en conserve dont l’ADN est fortement dégradé et dont les longueurs des fragments se révèlent insuffisantes pour l’amplification des cibles. En outre, la méthode présentée ici n’est pas applicable aux produits complexes à base de poisson qui mélangent deux espèces de poissons et plus.

Živila - Črtno kodiranje DNK rib in ribjih proizvodov z uporabo segmentov genov, ki nosijo zapis za mitohondrijski citokrom b in citokrom c oksidaze I

Ta metoda določa postopek za identifikacijo posameznih surovih, hladno prekajenih, soljenih, zamrznjenih ali kuhanih (prekuhanih, pečenih, ocvrtih, vroče dimljenih) rib in ribjih filejev glede na rod ali vrsto.
Identifikacija vrst rib se izvaja s povečanjem polimerazne verižne reakcije (PCR) segmenta mitohondrijskega gena za citokrom b (cytb) ali gena za citokrom c oksidaze I (cox1, syn COI) ali obojega, čemur sledi sekvenciranje produktov polimerazne verižne reakcije in nadaljnja primerjava sekvenc z vnosi v zbirkah podatkov. Metodologija omogoča identifikacijo velikega števila komercialno pomembnih vrst rib.
Odločitev o tem, ali se za identifikacijo rib uporablja segment gena cytb ali cox1 ali oba, je odvisna od navedene vrste rib, uporabnosti metode polimerazne verižne reakcije za vrsto rib in razpoložljivosti primerjalnih sekvenc v javnih zbirkah podatkov.
Ta standard običajno ni primeren za analizo živil z visoko stopnjo predelave, npr. ribjih konzerv, z zelo razgrajeno DNK, pri katerih dolžine delcev ne zadostujejo za povečanje ciljev. Poleg tega se ne uporablja za kompleksne ribje proizvode, ki vsebujejo mešanico dveh ali več vrst rib.

General Information

Status
Withdrawn
Publication Date
26-Mar-2019
Withdrawal Date
13-Apr-2025
Technical Committee
CEN/TC 460 - Food Authenticity
Current Stage
9960 - Withdrawal effective - Withdrawal
Start Date
18-Sep-2024
Completion Date
14-Apr-2025

Relations

Effective Date
18-Jan-2023
Technical specification

TS CEN/TS 17303:2019

English language
25 pages
Preview
Preview
e-Library read for
1 day

Frequently Asked Questions

CEN/TS 17303:2019 is a technical specification published by the European Committee for Standardization (CEN). Its full title is "Foodstuffs - DNA barcoding of fish and fish products using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments". This standard covers: This document describes a procedure for the identification of single fish and fish fillets to the level of genus or species. The identification of fish species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases. The methodology allows the identification of a large number of commercially important fish species. The decision whether the cytb or cox1 gene segment or both are used for fish identification depends on the declared fish species, the applicability of the PCR method for the fish species and the availability of comparative sequences in the public databases. This method has been successfully validated on raw fish fillets, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples. This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of fish, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex fish products containing mixtures of two or more fish species.

This document describes a procedure for the identification of single fish and fish fillets to the level of genus or species. The identification of fish species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases. The methodology allows the identification of a large number of commercially important fish species. The decision whether the cytb or cox1 gene segment or both are used for fish identification depends on the declared fish species, the applicability of the PCR method for the fish species and the availability of comparative sequences in the public databases. This method has been successfully validated on raw fish fillets, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples. This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of fish, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex fish products containing mixtures of two or more fish species.

CEN/TS 17303:2019 is classified under the following ICS (International Classification for Standards) categories: 67.120.30 - Fish and fishery products. The ICS classification helps identify the subject area and facilitates finding related standards.

CEN/TS 17303:2019 has the following relationships with other standards: It is inter standard links to EN ISO 17174:2024. Understanding these relationships helps ensure you are using the most current and applicable version of the standard.

CEN/TS 17303:2019 is associated with the following European legislation: EU Directives/Regulations: 882/2004. When a standard is cited in the Official Journal of the European Union, products manufactured in conformity with it benefit from a presumption of conformity with the essential requirements of the corresponding EU directive or regulation.

You can purchase CEN/TS 17303:2019 directly from iTeh Standards. The document is available in PDF format and is delivered instantly after payment. Add the standard to your cart and complete the secure checkout process. iTeh Standards is an authorized distributor of CEN standards.

Standards Content (Sample)


SLOVENSKI STANDARD
01-maj-2019
äLYLODýUWQRNRGLUDQMH'1.ULELQULEMLKSURL]YRGRY]XSRUDERVHJPHQWRYJHQRY
NLQRVLMR]DSLV]DPLWRKRQGULMVNLFLWRNURPELQFLWRNURPFRNVLGD]H,
Foodstuffs - DNA barcoding of fish and fish products using defined mitochondrial
cytochrome b and cytochrome c oxidase I gene segments
Lebensmittel - DNA-Barcoding von Fisch und Fischprodukten anhand definierter
mitochondrialer Cytochrom b- und Cytochrom c-Oxidase I-Genabschnitte
Produits alimentaires - Codes-barres d’ADN de poissons et de produits à base de
poissons à l'aide de segments de gènes mitochondriaux du cytochrome b et
cyctochrome c oxydase I
Ta slovenski standard je istoveten z: CEN/TS 17303:2019
ICS:
67.120.30 Ribe in ribji proizvodi Fish and fishery products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

CEN/TS 17303
TECHNICAL SPECIFICATION
SPÉCIFICATION TECHNIQUE
March 2019
TECHNISCHE SPEZIFIKATION
ICS 67.120.30
English Version
Foodstuffs - DNA barcoding of fish and fish products using
defined mitochondrial cytochrome b and cytochrome c
oxidase I gene segments
Produits alimentaires - Codes-barres d'ADN de Lebensmittel - DNA-Barcoding von Fisch und
poissons et de produits à base de poissons à l'aide de Fischprodukten anhand definierter mitochondrialer
segments de gènes mitochondriaux du cytochrome b et Cytochrom-b- und Cytochrom-c-Oxidase-I-
cyctochrome c oxydase I Genabschnitte
This Technical Specification (CEN/TS) was approved by CEN on 14 January 2019 for provisional application.

The period of validity of this CEN/TS is limited initially to three years. After two years the members of CEN will be requested to
submit their comments, particularly on the question whether the CEN/TS can be converted into a European Standard.

CEN members are required to announce the existence of this CEN/TS in the same way as for an EN and to make the CEN/TS
available promptly at national level in an appropriate form. It is permissible to keep conflicting national standards in force (in
parallel to the CEN/TS) until the final decision about the possible conversion of the CEN/TS into an EN is reached.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, Former Yugoslav Republic of Macedonia, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania,
Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland,
Turkey and United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION

EUROPÄISCHES KOMITEE FÜR NORMUNG

CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2019 CEN All rights of exploitation in any form and by any means reserved Ref. No. CEN/TS 17303:2019 E
worldwide for CEN national Members.

Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 7
5 Reagents and materials . 7
5.1 General . 7
5.2 PCR reagents . 8
6 Apparatus . 9
7 Procedure. 9
7.1 Sample preparation . 9
7.2 DNA extraction . 9
7.3 PCR . 9
7.3.1 General . 9
7.3.2 PCR setup . 10
7.3.3 Temperature-time program . 11
7.3.4 PCR controls . 11
8 Evaluation . 12
8.1 Evaluation of PCR products . 12
8.2 Evaluation of the PCR results . 12
8.3 Sequencing of PCR products . 12
8.4 Evaluation of sequence data . 13
8.5 Comparison of the sequence with public databases. 13
8.5.1 General . 13
8.5.2 Sequence comparison of cytb and/or cox1 DNA sequences with GenBank . 13
8.5.3 Sequence comparison of cox1 DNA sequences with BOLD . 14
9 Interpretation of database query results . 15
10 Validation status and performance criteria . 15
10.1 Collaborative study for the identification of fish species based on cytb sequence
analysis . 15
10.2 Collaborative study for the identification of fish species based on cox1 sequence
analysis . 16
11 Test report . 18
Annex A (informative) Practical laboratory experiences with the amplificability of cytb or
cox1 segments from tested fish species . 19
Bibliography . 24

European foreword
This document (CEN/TS 17303:2019) has been prepared by Technical Committee CEN/TC 275 “Food
analysis - Horizontal methods”, the secretariat of which is held by DIN.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
According to the CEN/CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to announce this Technical Specification: Austria, Belgium, Bulgaria,
Croatia, Cyprus, Czech Republic, Denmark, Estonia, Finland, Former Yugoslav Republic of Macedonia,
France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta,
Netherlands, Norway, Poland, Portugal, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland,
Turkey and the United Kingdom.
Introduction
Food safety is a key aspect in terms of consumer protection. In the last three decades, globalization has
taken place in the trade of food. Fish trade channels are becoming steadily longer and more complicated
so that sophisticated traceability tools are needed to ensure food safety. Correct food labelling is a
prerequisite to ensure safe fish products and fair trade as well as to minimize illegal, unreported and
unregulated (IUU) fishing. In particular, the fact that fish is increasingly being processed in export
countries makes the identification of species by morphological characteristics impossible.
The development of harmonized and standardized protocols for the authentication of fish products is
necessary to establish reliable methods for the detection of potential food fraud.
1 Scope
This document describes a procedure for the identification of single fish and fish fillets to the level of
genus or species.
The identification of fish species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) [1] or the cytochrome c oxidase I gene (cox1, syn COI) [2], [3] or
both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in
databases [4], [5]. The methodology allows the identification of a large number of commercially
important fish species.
The decision whether the cytb or cox1 gene segment or both are used for fish identification depends on
the declared fish species, the applicability of the PCR method for the fish species and the availability of
comparative sequences in the public databases.
This method has been successfully validated on raw fish fillets, however, laboratory experience is
available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked,
fried, deep-fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of fish, with
highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets.
Furthermore, it is not applicable for complex fish products containing mixtures of two or more fish
species.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
EN ISO 24276, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and
derived products — General requirements and definitions (ISO 24276)
ISO 16577, Molecular biomarker analysis — Terms and definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following
apply.
ISO and IEC maintain terminological databases for use in standardization at the following addresses:
— IEC Electropedia: available at http://www.electropedia.org/
— ISO Online browsing platform: available at http://www.iso.org/obp
3.1
alignment
process or result of matching up the nucleotide residues of two or more biological sequences to achieve
maximal levels of identity
[SOURCE: BLAST Glossary]
3.2
BLAST
(The Basic Local Alignment Search Tool) [4]
sequence comparison algorithm optimized for speed used to search sequence databases for optimal
local alignments to a query
Note 1 to entry: It directly approximates alignments that optimize a measure of local similarity, the maximum
signal pair (MSP) score or high scoring signal pair (HSP) score.
3.3
BOLD
(Barcode of Life Data Systems) [5]
informatics workbench aiding the acquisition, storage, analysis, and publication of DNA barcode
records
Note 1 to entry: By assembling molecular, morphological, and distributional data, it bridges a traditional
bioinformatics chasm. BOLD is freely available to any researcher with interests in DNA barcoding. By providing
specialized services, it aids the assembly of records that meet the standards needed to gain BARCODE designation
in the global sequence databases. Because of its web-based delivery and flexible data security model, it is also well
positioned to support projects that involve broad research alliances.
[SOURCE: BOLDSYSTEMS About Us]
3.4
FASTA format
text-based format for representing either nucleotide sequences or amino acid sequences, which begins
with a single-line description, followed by lines of sequence data
Note 1 to entry: The description line (defline) is distinguished from the sequence data by a greater-than (“>”)
symbol at the beginning.
[SOURCE: BLAST topics, modified]
EXAMPLE An example sequence in FASTA format is shown below:
> Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTCT
CAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACATT
ATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAACA
TACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTATT
CATAGAGACCTGAAACATTGGAGTTGTACTATTCCTTTTAGTAATAATGACCGCCTTCGTAGGCTACGTCCTCCCT
3.5
FishBase
global biodiversity online platform on finfishes providing a wide range of information on all species
currently known in the world
3.6
GenBank
comprehensive public database of e. g. genetic sequences [6]
Note 1 to entry: GenBank is part of the International Nucleotide Sequence Database Collaboration, which
comprises the DNA DataBank of Japan (DDBJ), the European Nucleotide Archive (ENA), and GenBank at National
Center for Biotechnology Information (NCBI). These three organizations exchange data on a daily basis.
3.7
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
[Source: BLAST Glossary]
Note 1 to entry: In the database BOLD, the term similarity is used instead of identity.
3.8
introgressed DNA
DNA sequence (allele) from one taxonomic entity (species) incorporated in the gene pool of another,
divergent entity (species)
Note 1 to entry: Introgression has usually happened via hybridization and backcrossing of individuals
belonging to different species.
3.9
NCBI (National Center for Biotechnology Information)
institution which houses molecular biology databases (e.g. GenBank) and provides the BLAST suite
3.10
nucleotide collection (nr/nt)
non-redundant database consisting of GenBank sequences, in which identical sequences have been
merged into one entry
3.11
query
sequence (or other type of search term) to which all of the entries in a data base are to be compared
[SOURCE: BLAST Glossary].
3.12
query coverage
percentage of query covered by alignment to the data base sequence
[SOURCE: BLAST help]
4 Principle
DNA is extracted from fish and fish products applying a suitable method. Segments of approximately
460 base pairs of the cytb gene and/or approximately 650 base pairs of the cox1 gene are amplified by
PCR. In the further course, the nucleotide sequence of the PCR product is determined by a suitable DNA
sequencing method (e.g. Sanger sequencing). The sequence is evaluated by comparison to sequence
entries in databases, thus allowing the assignment to a fish species or genus according to the degree of
identity with stored sequences.
5 Reagents and materials
5.1 General
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled or demineralized water or water of equivalent purity, according to EN ISO 24276.
Regarding laboratory organization, see EN ISO 24276.
5.2 PCR reagents
5.2.1 Thermostable DNA polymerase (for hot start PCR)
5.2.2 PCR reaction buffer (including MgCl or with separate MgCl solution)
2 2
5.2.3 Deoxynucleoside triphosphate mix (dATP, dCTP, dGTP and dTTP)
5.2.4 Oligonucleotides (see Tables 1 and 2)
Table 1 — Oligonucleotides for amplification of the cytb gene region [1]
Name DNA Sequence of oligonucleotide
L14735 5'-AAA AAC CAC CGT TGT TAT TCA ACT A-3'
H15149ad 5'-GCI CCT CAR AAT GAY ATT TGT CCT CA-3'
Table 2 — Oligonucleotides for amplification of the cox1 gene region [2], [3]
Name DNA Sequence of oligonucleotide
VF2_t1 5'-TGT AAA ACG ACG GCC AGT CAA CCA ACC ACA AAG ACA TTG GCA C-3'
FishF2_t1 5'-TGT AAA ACG ACG GCC AGT CGA CTA ATC ATA AAG ATA TCG GCA C-3'
FishR2_t1 5'-CAG GAA ACA GCT ATG ACA CTT CAG GGT GAC CGA AGA ATC AGA A-3'
FR1d_t1 5'-CAG GAA ACA GCT ATG ACA CCT CAG GGT GTC CGA ARA AYC ARA A-3'
M13 tails of the primers are highlighted in bold and italic.
5.2.5 Agarose
5.2.6 Suitable DNA length standard for assessing the amplification product length
5.2.7 Sequencing primers [3] (see Table 3)
Table 3 — Sequencing primers for cox1 PCR products
Name DNA Sequence of oligonucleotide
M13F (−21) 5'-TGT AAA ACG ACG GCC AGT-3'
M13R (−27) 5'-CAG GAA ACA GCT ATG AC-3'

During the collaborative study the Maxima® Hot Start PCR Master Mix (2 x) of Fermentas GmbH (ready to use PCR
buffer solution including thermostable DNA polymerase) was used for the cytb amplification and the BIOTAQ DNA
polymerase of Bioline with 10 x reaction buffer and separate MgCl solution for the cox1 amplification. In addition to the
recommended BIOTAQ DNA polymerase other mastermixes and polymerases were successfully used in the
collaborative study.
Deoxynucleotide triphosphates can also be part of a commercial PCR master mix.
6 Apparatus
Apart from the usual laboratory equipment, the following equipment is required:
6.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA
6.2 Thermocycler
6.3 Gel electrophoresis device
6.4 Gel documentation system
6.5 DNA sequencer
7 Procedure
7.1 Sample preparation
It should be ensured that the test portion used for DNA extraction is representative for the laboratory
sample. In composed samples (e.g. ready-to-use meals), single pure fish pieces have to be separated and
analysed. With the analysis of samples composed of several pieces (e.g. bags with different fillets), test
portions for every putative fish species are taken and analysed separately. To minimize the risk of
amplifying adhering contaminants, test sample material shall not be taken from the surface of the
laboratory sample. For further information regarding sample preparation, see ISO 20813 .
7.2 DNA extraction
Concerning the extraction of DNA from the test sample, the general instructions and measures
described in EN ISO 21571 should be followed, see ISO 20813 . It is recommended to choose one of the
DNA extraction methods described in EN ISO 21571:2005, Annex A . Alternatively, commercial kits can
be used for the extraction and purification of DNA.
7.3 PCR
7.3.1 General
The primers used for the amplification of the section from the mitochondrial cytb gene are universal
primers. The primer L14735 binds to a section in the neighbouring highly conserved tRNA-Glu gene.
The primer H15149ad is a universal primer with fish-specific adaptations [1]. It is currently known that
with some exceptions the primer pair L14735/H15149ad did not react with samples labelled as
Barramundi (Lates calcarifer) or Nile perch (Lates niloticus) [7].
The primers used for the amplification of the section from the mitochondrial cox1 gene were designed
to amplify a segment from the 5' region of the cox1 gene of fish [2]. The primer pair has been tested
against a very broad taxonomic range of fish species, and has only failed in a small minority of cases
(< 5 % of species tested) [3].

Under development; currently at approval stage as ISO/FDIS 20813.
EN ISO 21571:2005 is currently impacted by EN ISO 21571:2005/A1:2013.
7.3.2 PCR setup
The method was validated for a total volume of 20 µl (cox1) or 25 µl (cytb) per PCR. The reagents given
in Table 4 and Table 5 should be used for the cytb and cox1 PCR, respectively.
Reagents are completely thawed at room temperature and should be centrifuged briefly before usage. A
PCR reagent mixture is prepared containing all PCR components in the given concentrations except for
the DNA extract. The amount of PCR mixture depends on the total volume per PCR and the total number
of the reactions including a sufficient pipetting reserve.
Positive PCR results are expected when using a DNA concentration of approximately 1 ng/µl reaction
solution. If it is necessary to improve the PCR result, the inserted DNA quantity may be increased (e.g. to
increase the yield of PCR product) or decreased (e.g. to avoid PCR inhibition).
Table 4 — Components for the cytb PCR
Reagent (stock solution) Final concentration in the reaction solution
PCR buffer 1 x
a 1,5 mmol/l
MgCl
a 0,2 mmol/l for each dNTP
dNTP mix
Primer L14735 500 nmol/l
Primer H15149ad 500 nmol/l
Hot-start DNA Polymerase 0,5 units to 1 unit
Water Add to obtain final volume
Sample DNA About 1 ng/µl
a
Use reagent only if not already included in the PCR buffer
Table 5 — Components for the cox1 PCR
Reagent (stock solution) Final concentration in the reaction solution
a 5 %
Trehalose
PCR buffer 1 x
b 2,5 mmol/l
MgCl
b 0,2 mmol/l for each dNTP
dNTP mix
Primer VF2_t1 100 nmol/l
Primer FishF2_t1 100 nmol/l
Primer FishR2_t1 100 nmol/l
Primer FR1d_t1 100 nmol/l
Hot-start DNA Polymerase 0,5 units
Water Add to obtain final volume
Sample DNA About 1 ng/µl
a
optional
b
Use reagent only if not already included in the PCR buffer
Mix the PCR reagent mixture, centrifuge briefly and split into the individual reactions. Pipette the DNA
extracts to be examined or the PCR controls (see 7.3.3) into the different reaction solutions. Transfer
the reaction setups into the thermal cycler and start the temperature-time program.
For further information on PCR controls, see also ISO 20813 .
7.3.3 Temperature-time program
The temperature-time programs as outlined in Tables 6 and 7 have been successfully used in the
collaborative studies. The use of different reagent conditions and PCR cyclers can require specific
optimization. The time for initial denaturation depends on the hot-start polymerase used.
Table 6 — Temperature-time program for the cytb PCR
Step Parameter Temperature Time Cycles
Initial denaturation / activation
1 95 °C 15 min 1
of the hot-start polymerase
Denaturation 95 °C 40 s
2 Amplification Annealing 50 °C 80 s 35
Elongation 72 °C 80 s
3 Final elongation 72 °C 10 min 1
Table 7 — Temperature-time program for the cox1 PCR
Step Parameter Temperature Time Cycles
Initial denaturation / activation
1 94 °C 2 min 1
of the hot-start polymerase
Denaturation 94 °C 30 s
2 Amplification Annealing 52 °C 40 s 35
Elongation 72 °C 60 s
3 Final elongation 72 °C 10 min 1
After the PCR is finished, store samples in the refrigerator until further analysis.
7.3.4 PCR controls
In addition to the reaction setups for the samples to be analysed, an amplification reagent control and
an extraction blank control (see EN ISO 24276) have to be included.
A positive DNA target control (see EN ISO 24276) can be helpful to demonstrate the ability of the PCR to
amplify the target sequence. As positive control material, genomic DNA extracted from a known fish
species or an available plasmid containing the target sequence can be used.
If a sample shows no amplification in both targets it may be helpful to exclude an inhibition of the PCR
by performing an inhibition control reaction (see EN ISO 24276). This can be done either by dilution of
sample DNA or by using an internal inhibition control assay.
Regarding the PCR controls, see also ISO 20813 .
8 Evaluation
8.1 Evaluation of PCR products
The PCR product can be assessed, and quality and quantity can be estimated, e.g. by agarose gel
electrophoresis.
Gel electrophoresis of D
...

Questions, Comments and Discussion

Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.

Loading comments...